Protein Molecular Weight Calculator from DNA Sequence

Calculator Inputs

Use the responsive grid below. Large screens show three columns, smaller screens show two, and mobile shows one.

Sequence Name

Strand Type

Reading Frame

Translation Start

Stop Codon Handling

Mass Mode

Unknown Residue Policy

Add terminal water mass

Keeps the peptide as a full molecule.

Standard genetic code is used. Sequence cleaning removes spaces, digits, and punctuation before translation.

DNA Sequence

Example Data Table

These examples assume the standard code, coding strand input, frame 1, stop at first stop codon, average masses, and terminal water included.

DNA Sequence	Translated Protein	Protein Length	Estimated Molecular Weight
`ATGGCCATTGTAATGGGCCGCTGA`	`MAIVMGR`	7 aa	777.0107 Da
`ATGGAGGAGAAGTAA`	`MEEK`	4 aa	535.6060 Da
`ATGGTGCCCGGCTTACAA`	`MVPGLQ`	6 aa	643.8011 Da

Formula Used

Protein molecular weight is calculated as the sum of all translated residue masses. When terminal water is enabled, one water molecule is added back to represent the complete peptide.

Protein MW = Σ(residue masses) + terminal water correction

Average mode uses average isotopic residue masses. Monoisotopic mode uses exact monoisotopic residue masses. Stop codons are excluded from the mass total. Unknown residues can be excluded or estimated with a generic residue mass.

GC% = ((G + C) / (A + T + G + C)) × 100

When a template strand is provided, the calculator first builds the reverse complement, then applies the selected reading frame and translation settings.

How to Use This Calculator

Paste the DNA sequence into the input box. The cleaner removes spaces, numbers, and punctuation automatically.
Choose whether the sequence is already a coding strand or a template strand.
Select the reading frame, translation start rule, stop handling method, and mass mode.
Decide whether terminal water should be included for a full peptide mass.
Set how unknown residues should affect the final total.
Press the calculate button. The result appears below the header and above the form, along with the translated protein, metrics, composition table, graph, and download tools.

Frequently Asked Questions

1. Does this tool translate DNA before calculating mass?

Yes. It first orients the sequence, applies the chosen frame, translates codons with the standard genetic code, then totals amino acid residue masses.

2. Can I paste a template strand instead of a coding strand?

Yes. Choose the template option and the calculator creates the reverse complement before translation, so the protein is derived from the proper coding orientation.

3. Why does average mass differ from monoisotopic mass?

Average mass reflects natural isotope abundance. Monoisotopic mass uses the lightest exact isotopes. Monoisotopic values are preferred for high-resolution mass spectrometry work.

4. What happens when the sequence contains ambiguous bases?

Ambiguous codons become X in the protein. You can exclude those residues from the total or estimate them with a generic residue mass.

5. Are stop codons included in the molecular weight?

No. Stop codons terminate translation or appear as markers, depending on your setting, but they are never counted as amino acid mass.

6. Does the calculator include post-translational modifications?

No. It reports the unmodified translated peptide or protein mass. Add any modification masses separately if your experiment includes them.

7. Why can the translated protein be shorter than expected?

Short outputs usually come from the selected frame, an early stop codon, missing ATG search hits, or trailing nucleotides that do not complete a codon.

8. Is this suitable for genomic DNA with introns?

Not directly. This calculator expects a continuous coding region. Splice introns out first, then analyze the mature coding sequence.